Project name: example
Run name: example
Read type: Single-end 301bp
Samples: 78
Total reads: 1,791,677
Mean reads per sample: 22,970
Report generated: Fri Mar 24 16:14:10 CDT 2023
Variable region: V4
| general.projectname | general.readlength | general.runname | subsample.rawreads | subsample.subsampledreads | dada2.chimeric | dada2.filtered | dada2.good | dada2.noadapter | dada2.noise | dada2.notmerged | |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Mo104.38726.06042013.L001 | example | 301 | example | 26544.00 | 26544.00 | 3180.00 | 6375.00 | 15917.00 | 16.00 | 1056.0 | 0 |
| Mo104.38726.07012013.L001 | example | 301 | example | 23638.00 | 23638.00 | 2136.00 | 8300.00 | 12097.00 | 23.00 | 1082.0 | 0 |
| Mo104.38726.08132013.L001 | example | 301 | example | 12961.00 | 12961.00 | 559.00 | 2844.00 | 8907.00 | 6.00 | 645.0 | 0 |
| Mo104.38726.09032013.L001 | example | 301 | example | 19656.00 | 19656.00 | 1812.00 | 3950.00 | 12889.00 | 9.00 | 996.0 | 0 |
| Mo104.38727.06042013.L001 | example | 301 | example | 45038.00 | 45038.00 | 6564.00 | 9879.00 | 27106.00 | 38.00 | 1451.0 | 0 |
| Mo104.38727.07012013.L001 | example | 301 | example | 38915.00 | 38915.00 | 4864.00 | 8368.00 | 24286.00 | 26.00 | 1371.0 | 0 |
| Mo104.38727.08132013.L001 | example | 301 | example | 21854.00 | 21854.00 | 1407.00 | 4927.00 | 14449.00 | 19.00 | 1052.0 | 0 |
| Mo104.38727.09032013.L001 | example | 301 | example | 28365.00 | 28365.00 | 970.00 | 11003.00 | 15145.00 | 31.00 | 1216.0 | 0 |
| Mo104.38933.06042013.L001 | example | 301 | example | 32704.00 | 32704.00 | 4142.00 | 7735.00 | 19580.00 | 16.00 | 1231.0 | 0 |
| Mo104.38933.07012013.L001 | example | 301 | example | 25287.00 | 25287.00 | 2127.00 | 8920.00 | 13159.00 | 20.00 | 1061.0 | 0 |
| Mo104.38933.08132013.L001 | example | 301 | example | 29369.00 | 29369.00 | 2390.00 | 6479.00 | 19195.00 | 28.00 | 1277.0 | 0 |
| Mo104.38933.09032013.L001 | example | 301 | example | 10945.00 | 10945.00 | 786.00 | 2275.00 | 7208.00 | 6.00 | 670.0 | 0 |
| Mo104.38986.06042013.L001 | example | 301 | example | 23164.00 | 23164.00 | 3021.00 | 4785.00 | 14396.00 | 7.00 | 955.0 | 0 |
| Mo104.38986.07012013.L001 | example | 301 | example | 19421.00 | 19421.00 | 717.00 | 4046.00 | 13555.00 | 22.00 | 1081.0 | 0 |
| Mo104.38986.08132013.L001 | example | 301 | example | 47815.00 | 47815.00 | 4154.00 | 10656.00 | 31437.00 | 40.00 | 1528.0 | 0 |
| Mo104.38986.09032013.L001 | example | 301 | example | 25406.00 | 25406.00 | 1603.00 | 11743.00 | 10811.00 | 13.00 | 1236.0 | 0 |
| Mo104.39104.06042013.L001 | example | 301 | example | 41530.00 | 41530.00 | 5331.00 | 9316.00 | 25645.00 | 33.00 | 1205.0 | 0 |
| Mo104.39104.06272013.L001 | example | 301 | example | 24578.00 | 24578.00 | 1481.00 | 7647.00 | 14470.00 | 18.00 | 962.0 | 0 |
| Mo104.39104.07012013.L001 | example | 301 | example | 34836.00 | 34836.00 | 3851.00 | 7162.00 | 22470.00 | 37.00 | 1316.0 | 0 |
| Mo104.39104.07082013.L001 | example | 301 | example | 39076.00 | 39076.00 | 3741.00 | 7809.00 | 25879.00 | 38.00 | 1609.0 | 0 |
| Mo104.39104.07152013.L001 | example | 301 | example | 23340.00 | 23340.00 | 2315.00 | 4980.00 | 14868.00 | 19.00 | 1158.0 | 0 |
| Mo104.39154.06042013.L001 | example | 301 | example | 71166.00 | 71166.00 | 13506.00 | 13761.00 | 41376.00 | 72.00 | 2451.0 | 0 |
| Mo104.39154.06272013.L001 | example | 301 | example | 40014.00 | 40014.00 | 7716.00 | 8080.00 | 22822.00 | 30.00 | 1366.0 | 0 |
| Mo104.39154.07012013.L001 | example | 301 | example | 51635.00 | 51635.00 | 6379.00 | 11137.00 | 32237.00 | 36.00 | 1846.0 | 0 |
| Mo104.39154.07082013.L001 | example | 301 | example | 20827.00 | 20827.00 | 2489.00 | 4828.00 | 12481.00 | 21.00 | 1008.0 | 0 |
| Mo104.39154.07152013.L001 | example | 301 | example | 17522.00 | 17522.00 | 794.00 | 7973.00 | 7357.00 | 7.00 | 1391.0 | 0 |
| Mo104.39368.06042013.L001 | example | 301 | example | 19022.00 | 19022.00 | 3148.00 | 3965.00 | 10935.00 | 21.00 | 953.0 | 0 |
| Mo104.39368.06272013.L001 | example | 301 | example | 17837.00 | 17837.00 | 1759.00 | 3932.00 | 10994.00 | 21.00 | 1131.0 | 0 |
| Mo104.39368.07012013.L001 | example | 301 | example | 14452.00 | 14452.00 | 1369.00 | 3248.00 | 8832.00 | 7.00 | 996.0 | 0 |
| Mo104.39368.07082013.L001 | example | 301 | example | 25747.00 | 25747.00 | 2754.00 | 5468.00 | 16120.00 | 32.00 | 1373.0 | 0 |
| Mo104.39368.07162013.L001 | example | 301 | example | 17730.00 | 17730.00 | 1480.00 | 4095.00 | 11181.00 | 11.00 | 963.0 | 0 |
| Mo104.39595.06042013.L001 | example | 301 | example | 17669.00 | 17669.00 | 1144.00 | 5848.00 | 9671.00 | 11.00 | 995.0 | 0 |
| Mo104.39595.06272013.L001 | example | 301 | example | 20691.00 | 20691.00 | 1458.00 | 4749.00 | 13424.00 | 14.00 | 1046.0 | 0 |
| Mo104.39595.07012013.L001 | example | 301 | example | 33880.00 | 33880.00 | 2325.00 | 9756.00 | 20509.00 | 36.00 | 1254.0 | 0 |
| Mo104.39595.07082013.L001 | example | 301 | example | 12901.00 | 12901.00 | 652.00 | 2633.00 | 8779.00 | 13.00 | 824.0 | 0 |
| Mo104.39595.07162013.L001 | example | 301 | example | 44755.00 | 44755.00 | 4467.00 | 10175.00 | 28316.00 | 45.00 | 1752.0 | 0 |
| Mo104.39652.06042013.L001 | example | 301 | example | 30122.00 | 30122.00 | 1882.00 | 6424.00 | 20583.00 | 18.00 | 1215.0 | 0 |
| Mo104.39652.07012013.L001 | example | 301 | example | 23735.00 | 23735.00 | 2379.00 | 4704.00 | 15522.00 | 18.00 | 1112.0 | 0 |
| Mo104.39652.08132013.L001 | example | 301 | example | 33821.00 | 33821.00 | 3586.00 | 7701.00 | 21164.00 | 18.00 | 1352.0 | 0 |
| Mo104.39652.08222013.L001 | example | 301 | example | 10651.00 | 10651.00 | 350.00 | 3111.00 | 6523.00 | 13.00 | 654.0 | 0 |
| Mo104.39652.08272013.L001 | example | 301 | example | 33901.00 | 33901.00 | 3115.00 | 8312.00 | 21248.00 | 30.00 | 1196.0 | 0 |
| Mo104.39652.09032013.L001 | example | 301 | example | 17440.00 | 17440.00 | 374.00 | 6456.00 | 9691.00 | 19.00 | 900.0 | 0 |
| Mo104.39652.09092013.L001 | example | 301 | example | 5380.00 | 5380.00 | 57.00 | 1175.00 | 3609.00 | 9.00 | 530.0 | 0 |
| Mo104.39741.06042013.L001 | example | 301 | example | 20912.00 | 20912.00 | 2089.00 | 4269.00 | 13471.00 | 19.00 | 1064.0 | 0 |
| Mo104.39741.07012013.L001 | example | 301 | example | 30277.00 | 30277.00 | 2000.00 | 6648.00 | 20165.00 | 30.00 | 1434.0 | 0 |
| Mo104.39741.08132013.L001 | example | 301 | example | 40759.00 | 40759.00 | 3391.00 | 8976.00 | 26791.00 | 30.00 | 1571.0 | 0 |
| Mo104.39741.08222013.L001 | example | 301 | example | 25032.00 | 25032.00 | 1796.00 | 5739.00 | 16437.00 | 19.00 | 1041.0 | 0 |
| Mo104.39741.08272013.L001 | example | 301 | example | 17139.00 | 17139.00 | 933.00 | 6688.00 | 8539.00 | 27.00 | 952.0 | 0 |
| Mo104.39741.09032013.L001 | example | 301 | example | 15076.00 | 15076.00 | 708.00 | 3608.00 | 9982.00 | 11.00 | 767.0 | 0 |
| Mo104.39741.09092013.L001 | example | 301 | example | 13160.00 | 13160.00 | 533.00 | 4264.00 | 7621.00 | 14.00 | 728.0 | 0 |
| Mo104.39788.06042013.L001 | example | 301 | example | 17681.00 | 17681.00 | 2356.00 | 3788.00 | 10606.00 | 27.00 | 904.0 | 0 |
| Mo104.39788.07012013.L001 | example | 301 | example | 13892.00 | 13892.00 | 507.00 | 4558.00 | 7798.00 | 67.00 | 962.0 | 0 |
| Mo104.39788.08132013.L001 | example | 301 | example | 14960.00 | 14960.00 | 534.00 | 6403.00 | 7097.00 | 98.00 | 828.0 | 0 |
| Mo104.39788.08222013.L001 | example | 301 | example | 7839.00 | 7839.00 | 271.00 | 1680.00 | 5158.00 | 104.00 | 626.0 | 0 |
| Mo104.39788.08272013.L001 | example | 301 | example | 18339.00 | 18339.00 | 773.00 | 3717.00 | 12682.00 | 131.00 | 1036.0 | 0 |
| Mo104.39788.09032013.L001 | example | 301 | example | 31761.00 | 31761.00 | 2329.00 | 6757.00 | 21137.00 | 138.00 | 1400.0 | 0 |
| Mo104.39788.09102013.L001 | example | 301 | example | 19956.00 | 19956.00 | 884.00 | 5151.00 | 12890.00 | 20.00 | 1011.0 | 0 |
| Mo104.39846.06042013.L001 | example | 301 | example | 10807.00 | 10807.00 | 203.00 | 5344.00 | 4512.00 | 9.00 | 739.0 | 0 |
| Mo104.39846.07012013.L001 | example | 301 | example | 12254.00 | 12254.00 | 223.00 | 2724.00 | 8417.00 | 14.00 | 876.0 | 0 |
| Mo104.39846.08132013.L001 | example | 301 | example | 17336.00 | 17336.00 | 2709.00 | 3603.00 | 10261.00 | 18.00 | 745.0 | 0 |
| Mo104.39846.08222013.L001 | example | 301 | example | 14511.00 | 14511.00 | 762.00 | 3121.00 | 9770.00 | 12.00 | 846.0 | 0 |
| Mo104.39846.08272013.L001 | example | 301 | example | 24995.00 | 24995.00 | 1616.00 | 5179.00 | 16841.00 | 29.00 | 1330.0 | 0 |
| Mo104.39846.09032013.L001 | example | 301 | example | 8706.00 | 8706.00 | 263.00 | 2080.00 | 5595.00 | 10.00 | 758.0 | 0 |
| Mo104.39846.09102013.L001 | example | 301 | example | 33747.00 | 33747.00 | 2068.00 | 11362.00 | 18879.00 | 27.00 | 1411.0 | 0 |
| Mo104.39899.06042013.L001 | example | 301 | example | 11361.00 | 11361.00 | 857.00 | 3153.00 | 6501.00 | 17.00 | 833.0 | 0 |
| Mo104.39899.07012013.L001 | example | 301 | example | 23321.00 | 23321.00 | 726.00 | 9909.00 | 11597.00 | 15.00 | 1074.0 | 0 |
| Mo104.39899.08132013.L001 | example | 301 | example | 19875.00 | 19875.00 | 553.00 | 4447.00 | 13984.00 | 31.00 | 860.0 | 0 |
| Mo104.39899.08222013.L001 | example | 301 | example | 16271.00 | 16271.00 | 1172.00 | 3364.00 | 10738.00 | 14.00 | 983.0 | 0 |
| Mo104.39899.08272013.L001 | example | 301 | example | 8295.00 | 8295.00 | 381.00 | 1925.00 | 5235.00 | 11.00 | 743.0 | 0 |
| Mo104.39899.09032013.L001 | example | 301 | example | 6983.00 | 6983.00 | 204.00 | 1613.00 | 4492.00 | 11.00 | 663.0 | 0 |
| Mo104.39899.09112013.L001 | example | 301 | example | 10700.00 | 10700.00 | 349.00 | 2616.00 | 7122.00 | 13.00 | 600.0 | 0 |
| Mo104.39909.06042013.L001 | example | 301 | example | 18596.00 | 18596.00 | 1356.00 | 6294.00 | 9899.00 | 18.00 | 1029.0 | 0 |
| Mo104.39909.07012013.L001 | example | 301 | example | 7984.00 | 7984.00 | 172.00 | 1690.00 | 5559.00 | 8.00 | 555.0 | 0 |
| Mo104.39909.08132013.L001 | example | 301 | example | 18591.00 | 18591.00 | 1113.00 | 4119.00 | 12414.00 | 9.00 | 936.0 | 0 |
| Mo104.39909.08222013.L001 | example | 301 | example | 10354.00 | 10354.00 | 239.00 | 2184.00 | 7220.00 | 15.00 | 696.0 | 0 |
| Mo104.39909.08272013.L001 | example | 301 | example | 22656.00 | 22656.00 | 1860.00 | 5486.00 | 14368.00 | 23.00 | 919.0 | 0 |
| Mo104.39909.09032013.L001 | example | 301 | example | 20086.00 | 20086.00 | 770.00 | 6506.00 | 11832.00 | 19.00 | 959.0 | 0 |
| Mo104.39909.09112013.L001 | example | 301 | example | 12126.00 | 12126.00 | 976.00 | 2465.00 | 7907.00 | 84.00 | 694.0 | 0 |
| Mean | undef | 301 | example | 22970.23 | 22970.23 | 2025.77 | 5745.64 | 14107.18 | 27.04 | 1064.6 | 0 |
Order samples by
The number of reads per sample at the start of the analysis is shown.
The number of reads failing each preprocessing step is shown. No primer: reads removed by Cutadapt because they don’t contain the expected PCR primer sequence at the beginning of the R1 read or the end of the R2 read. Filtered: reads removed by Dada2 due to low base quality scores. Noise: reads discarded by the Dada2 denoising algorithm. Chimeric: reads discarded by Dada2 because they contain chimeric sequence. Good: reads passing all filter steps.
The taxonomic composition of each sample is shown, down to taxon level 4 (Order). The data shown here is a subset of the information that can be seen by loading the taxa-bar-plots.qvz qiime visualization file at the view.qiime2.org website (see the Data section of this report).
This is a Principal Coordinates Analysis (PCoA) plot, generated from a weighted UniFrac distance matrix. The first three principal components are shown, and the percent of total variation explained by each component is shown in the axis titles. Samples with similar biological communities appear close to each other, and samples with dissimilar communities are farther apart. Ideally samples will cluster by experimental condition and not by batch or other technical effects. This metric is calculated by Qiime2.
The data folder accompanying this report contains the following folders and files:
Qiime2 visualization files (.qzv) should be viewed using the online browser at https://view.qiime2.org
alpha-rarefaction.qzv
bray_curtis_emperor.qzv
jaccard_emperor.qzv
pcoa-visualization.qzv
rep-seqs.qzv
table.qzv
taxa-bar-plots.qzv
taxonomy.qzv
unweighted_unifrac_emperor.qzv
weighted_unifrac_emperor.qzv
Qiime2 artifact files (.qza) contain the data and metadata from an analysis. These files can be analyzed further in Qiime2, or you can view the contents of the files using the online browser at https://view.qiime2.org. The contents of the artifact files have also been exported into standard formats (see q2-exports) for use outside of Qiime2.
aligned-rep-seqs.qza
bray_curtis_distance_matrix.qza
bray_curtis_pcoa_results.qza
evenness_vector.qza
faith_pd_vector.qza
jaccard_distance_matrix.qza
jaccard_pcoa_results.qza
masked-aligned-rep-seqs.qza
observed_otus_vector.qza
rarefied_table.qza
rawdata.qza
rep-seqs.qza
rooted-tree.qza
shannon_vector.qza
stats-dada2.qza
table.qza
taxonomy.qza
unrooted-tree.qza
unweighted_unifrac_distance_matrix.qza
unweighted_unifrac_pcoa_results.qza
weighted_unifrac_distance_matrix.qza
weighted_unifrac_pcoa_results.qza
The contents of some Qiime2 artifact files have been exported into standard formats for use outside of Qiime2.
dna-sequences.fasta
feature-table.biom
feature-table.txt
stats.tsv
taxonomy.tsv
tree.nwk
Quality of data in fastq files was assessed with FastQC. Primer sequences were trimmed off the 5’ ends of reads using cutadapt, reads without a primer were discarded (cutadapt -g “^GTGCCAGCMGCCGCGGTAA” -e .2 –discard-untrimmed). Adapter sequences were trimmed off the 3’ ends of reads using cutadapt (cutadapt -a “CTGTCTCTTATACACATCTCCGAGCCCACGAGAC”). Samples were denoised using dada2 (qiime dada2 denoise-single –p-trim-left 0 –p-trunc-len 0). The BIOM table was summarized with the Qiime2 ‘feature-table summarize’ command. A phylogenetic tree was created using qiime phylogeny align-to-tree-mafft-fasttree. Diversity analysis was perfomed using the Qiime2 ‘diversity core-metrics-phylogenetic’ command with a sampling depth of 3609 (the number of reads in the sample with the fewest reads). Alpha rarefaction analysis was perfomed using the Qiime2 ‘diversity alpha-rarefaction’ command with a maximum depth of 14107 (the mean number of reads per sample). Taxonomy was assigned using the Qiime2 ‘feature-classifier classify-sklearn’ command using a classifier trained on Silva release 132 99% identity OTUs from the 515F/806R 16s region. The Qiime2 command ‘emperor plot’ was used to generate visualizations of the PCoA results from the core-metrics-analysis.