Project name: UMGC_Project_563
Run name: UMGC_Project_563
Read type: Single-end 151bp
Samples: 7
Total reads: 13,934,928
Mean reads per sample: 1,990,704
Report generated: Thu Jan 26 18:48:28 CST 2023
| general.projectname | general.readlength | general.runname | subsample.rawreads | subsample.subsampledreads | fastqc.meanreadqualityR1 | fastqc.pct.adapter | fastqc.pct.deduplicated | fastqc.pct.dimer | fastqc.pct.gc | fastqc.sequencelength | fastqc.totalsequences | gbstrim.inputreads | gbstrim.no3cutsite | gbstrim.no5cutsite | gbstrim.pct.A | gbstrim.pct.ACAGA | gbstrim.pct.AGGTCCAA | gbstrim.pct.CAG | gbstrim.pct.CTCCGA | gbstrim.pct.GAATCGA | gbstrim.pct.GCTA | gbstrim.pct.TCACGCTCA | gbstrim.pct.TG | gbstrim.pct.no3cutsite | gbstrim.pct.no5cutsite | gbstrim.pct.no_padding | gbstrim.pct.readswithtrailingadapter | gbstrim.pct.removed | gbstrim.pct.tooshort | gbstrim.readswithtrailingadapter | gbstrim.removed | gbstrim.tooshort | gbs.enzyme | gbs.enzyme2 | |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| NA12878 | UMGC_Project_563 | 151 | UMGC_Project_563 | 1644435 | 1644435 | 32.00 | 6.75 | 26.21 | 0.01 | 53.00 | 151 | 1644435 | 1644435 | 66759.00 | 102791.0 | 12.62 | 11.75 | 8.30 | 9.06 | 5.08 | 0.17 | 9.07 | 7.53 | 11.69 | 4.06 | 6.25 | 14.41 | 35.56 | 17.62 | 7.31 | 584745.0 | 289688.0 | 120138.0 | sbfi | taqi |
| NA24143 | UMGC_Project_563 | 151 | UMGC_Project_563 | 1842306 | 1842306 | 32.30 | 4.50 | 25.96 | 0.02 | 53.00 | 151 | 1842306 | 1842306 | 69496.00 | 119015.0 | 12.47 | 11.76 | 8.52 | 8.68 | 4.96 | 0.35 | 9.13 | 7.93 | 11.65 | 3.77 | 6.46 | 14.32 | 25.65 | 14.97 | 4.74 | 472613.0 | 275824.0 | 87313.0 | sbfi | taqi |
| NA24149 | UMGC_Project_563 | 151 | UMGC_Project_563 | 2307539 | 2307539 | 32.60 | 5.05 | 23.58 | 0.03 | 53.00 | 151 | 2307539 | 2307539 | 88138.00 | 139616.0 | 12.21 | 11.73 | 8.60 | 9.18 | 5.73 | 0.28 | 8.93 | 8.11 | 11.62 | 3.82 | 6.05 | 13.74 | 27.94 | 15.08 | 5.21 | 644757.0 | 347976.0 | 120222.0 | sbfi | taqi |
| NA24385 | UMGC_Project_563 | 151 | UMGC_Project_563 | 1978176 | 1978176 | 32.00 | 6.08 | 25.66 | 0.02 | 53.00 | 151 | 1978176 | 1978176 | 82773.00 | 132466.0 | 12.14 | 11.31 | 8.14 | 9.23 | 5.45 | 0.23 | 9.34 | 7.74 | 11.43 | 4.18 | 6.70 | 14.09 | 32.54 | 17.20 | 6.31 | 643685.0 | 340150.0 | 124911.0 | sbfi | taqi |
| NA24631 | UMGC_Project_563 | 151 | UMGC_Project_563 | 2007399 | 2007399 | 32.50 | 4.85 | 24.80 | 0.02 | 53.00 | 151 | 2007399 | 2007399 | 75627.00 | 117517.0 | 12.60 | 11.95 | 8.62 | 8.82 | 5.32 | 0.19 | 9.10 | 7.96 | 11.76 | 3.77 | 5.85 | 14.05 | 27.05 | 14.70 | 5.08 | 543015.0 | 295054.0 | 101910.0 | sbfi | taqi |
| NA24694 | UMGC_Project_563 | 151 | UMGC_Project_563 | 1734200 | 1734200 | 32.10 | 5.89 | 26.42 | 0.02 | 53.00 | 151 | 1734200 | 1734200 | 66378.00 | 112914.0 | 12.52 | 11.73 | 8.23 | 9.20 | 5.30 | 0.21 | 9.09 | 7.56 | 11.46 | 3.83 | 6.51 | 14.36 | 31.91 | 16.50 | 6.16 | 553322.0 | 286121.0 | 106829.0 | sbfi | taqi |
| NA24695 | UMGC_Project_563 | 151 | UMGC_Project_563 | 2420874 | 2420874 | 32.40 | 6.37 | 21.80 | 0.03 | 54.00 | 151 | 2420874 | 2420874 | 92343.00 | 133913.0 | 12.33 | 11.84 | 8.52 | 9.35 | 6.15 | 0.19 | 8.86 | 8.00 | 11.60 | 3.81 | 5.53 | 13.81 | 32.12 | 16.92 | 7.57 | 777502.0 | 409631.0 | 183375.0 | sbfi | taqi |
| Mean | undef | 151 | UMGC_Project_563 | 1990704 | 1990704 | 32.27 | 5.64 | 24.92 | 0.02 | 53.14 | 151 | 1990704 | 1990704 | 77359.14 | 122604.6 | 12.41 | 11.72 | 8.42 | 9.07 | 5.43 | 0.23 | 9.07 | 7.83 | 11.60 | 3.89 | 6.19 | 14.11 | 30.40 | 16.14 | 6.05 | 602805.6 | 320634.9 | 120671.1 | undef | undef |
Order samples by
The number of reads per sample at the start of the analysis is shown.
This plot shows the mean base quality score for each position in a fastq file. The higher the score the better the base call. Green indicates very good quality, yellow indicates reasonable quality, and red indicates poor quality. The quality of calls degrade as the sequencing run progresses, so it is common to see base calls turning yellow towards the end of a read. It is common to see base calls turning red in short insert libraries (16s/18s, small RNA, amplicon). This metric is calculated by FastQC.
This plot shows the cumulative proportion of each sample in which sequencing adapter sequences have been seen at each position. Once an adapter sequence has been seen in a read it is counted as being present right through to the end of the read so the percentages only increase as the read length goes on. It is common to see significant adapter sequence content at the ends of reads in short insert libraries (16s/18s, small RNA, amplicon). This metric is calculated by FastQC.
This plot shows the percentage of reads that remain after deduplication (removing duplicated sequences), which is a measure of library diversity. Sequence data from genomic DNA libraries typically have high library diversity, and data from targeted sequencing libraries typically have low diversity. This metric is calculated by FastQC.
This is a Principal Components (PCA) plot. The first three principal components are shown, and the percent of total variation explained by each component is shown in the axis titles. Samples with similar characteristics appear close to each other, and samples with dissimilar characteristics are farther apart. Ideally samples will cluster by experimental condition and not by batch or other technical effects.
The mean read depth across all variants per sample is shown.
The fraction of missing genotype calls per sample is shown.
The fraction of missing genotype calls per site is shown.
The output folder generated by this analysis pipeline contains the following folders and files:
fastqc/ FastQC html files
variants.vcf.gz VCF variant file (compressed) containing 7 samples and 4620 markers on 4005 loci
variants.filt.vcf.gz Filtered VCF variant file (compressed) containing 7 samples and 4306 markers on 3757 loci
- Samples with > 50% missing genotypes, and variants with genotype calls in less than 80% of samples are removed; variants with maf < 1% are removed
- 0 samples removed:
One of the following adapter sequences is expected to be present at the beginning of each read in the raw fastq files:
[no adapter sequence present]
A
TG
CAG
GCTA
ACAGA
CTCCGA
GAATCGA
AGGTCCAA
TCACGCTCA
Some reads may read through into the Illumina adapter sequnce which begins with CTGTCTCTTATACACATCTCCGAG
Quality of data in fastq files was assessed with FastQC. GBStrim.pl was used to trim 5' padding sequences and readthrough into 3' padding sequences (https://bitbucket.org/jgarbe/gbstrim). Stacks2 was used to process the dataset. Low quality reads were removed with the process_radtags command using the options "-e bamHI --disable_rad_check -r -c -q -y gzfastq". The ustacks command was used to build de novo loci in each sample using the options " -p 2 --force-diff-len". All samples were used to build a catalog of loci with the cstacks command using the options " -p 8". All samples were matched against the cstacks catalog using the sstacks command. The tsv2bam command was used to store data by locus instead of by sample. The gstacks command was used to call variant sites and generate genotypes for each individual. The populations command was used to calculate various statistics and generate output files using the options "-r 0.65 --vcf --genepop --structure --fasta-loci --fstats --hwe -t 8".